Molecular diversity and predictability of Vibrio parahaemolyticus along…

3 Мар 2015 | Author: | Комментарии к записи Molecular diversity and predictability of Vibrio parahaemolyticus along… отключены
Honda NSF 100


Vibrio parahaemolyticus is a cause of seafood-related gastroenteritis and is an autochthonous member of marine and environments worldwide. One-hundred strains of V . parahaemolyticus were from water and plankton collected along the Georgian of the Black Sea during 28 months of collection.

All isolated strains tested for presence of tlh . trh . and tdh . A subset of were serotyped and tested for factors and markers of pandemicity. serotypes, five of which are relevant, were identified. all 170 isolates were negative for tdh . trh . and the Phenomenon, 7 possessed the GS-PCR and 27 the 850 bp sequence of V. parahaemolyticus pandemic

The V. parahaemolyticus population in the Black Sea was to be genomically heterogeneous by rep-PCR and the observed did not correlate with genomic diversity. Statistical was used to predict presence of V. as a function of water temperature, strongest concordance observed for Cape site samples of total variance = 70, P #x0003c; Results demonstrate a diverse of V . parahaemolyticus in the Black Sea, of which carry pandemic with increased water correlated to an increase in abundance of V. .

Keywords: Vibrio parahaemolyticus . modeling, Vibrionaceae . Black aquatic microbiology


parahaemolyticus . a halophilic bacterium, is a agent of seafood-related gastroenteritis, infections, and septicemia and is known to in marine, estuarine, and brackish environments globally with occurrence in fresh water et al. 1985 ; DePaola et al. 2000 ; et al. 2000 ; Alam et al.

2009 ). In addition to notoriety as a agent of human infection, the is autochthonous to marine and brackish ecosystems and, similar to Vibrio spp. degrades (Kaneko and Colwell, 1974 ; et al. 2007 ). One of its main virulence the type three secretion (TTSS2), plays an important in preventing predation of its host by organisms, suggesting the virulence have evolved via environmental (Matz et al. 2011 ). Little has been done on non-anthropocentric of this organism, but its ubiquity and with animals demonstrate its ecology extends beyond the body.

The majority of clinical encode the thermostable direct (TDH), within the V. parahaemolyticus island (Vp-PAI), one of the virulence responsible for enterotoxicity (Honda, ; Guang-Qing et al. 1995 ). However, clinical isolates do not encode but other hemolysins instead, as the TDH-related hemolysin (TRH), all encode the thermolabile hemolysin

It has also been reported two type three secretion (TTSS1 and TTSS2) are involved in V. pathogenicity (Bhattacharjee et al. 2006 ; Ono et al. ; Kodama et al. 2007 ; Matlawska-Wasowska et al.

). The TTSS1 found in all V. parahaemolyticus examined to date has been to translocate an effector protein into the cytosol of macrophages and DNA fragmentation and another effector (VP1680) has been shown to a role in cytotoxicity in eukaryotic (Bhattacharjee et al. 2006 ; Ono et al.

2006 ). Interestingly, V. parahaemolyticus lacking TDH, TRH, and have frequently been from patients not colonized by TRH-, and TTSS2-positive strains, TTSS1 is also responsible for in humans (Suthienkul et al. 1995 ; et al. 1997 ; Vuddhakul et al. 2000 ; et al.

2003 ; Cabanillas-Beltr#x000e1;n et al. 2006 ; et al. 2007 ; Meador et al. 2007 ; et al. 2007 ; Chao et al. 2009. ; Garc#x000ed;a et al. 2009 ; Harth et al. ).

V . parahaemolyticus has been frequently from water samples from the Black Sea and sporadic of gastroenteritis caused by this and related vibrios have been reported in the Sea of Azov (Libinzon et al. 1974. 1980. ; Shikulov et al.

1980 ; Clark et al. ; WHO, 2011 ). Further, pathogenic vibrios are known to be to the greater Caucasus (Narkevich et al. ; Gurbanov et al. 2011 ; Rashid et al. ) but the ecologies of these organisms are not in this region.

The increasing incidence of V. parahaemolyticus infections it is important to fully understand the of these regions in multiple so that public health can be made more accurately et al. 2010 ). Members of the Vibrionaceae are to have an intimate association planktonic organisms and many have demonstrated the role of conditions (namely water and salinity) on the density of these in water bodies.

Generally, an increase in temperature of a body is associated with an in Vibrio density (Turner et al. ; Oberbeckmann et al. 2012 ). To further the ecology of V. parahaemolyticus along the coast of the Black Sea we evaluated the of these organisms in water and fractions over a 28 month (June 2006 to October and modeled their presence in to environmental conditions (salinity, temperature, pH, and dissolved oxygen). We evaluated the molecular diversity and of virulence factors in a subset of V. isolates collected during study.

Materials and methods

samples were collected except July to September water was collected biweekly, five stations on the coast of the Sea (Figure #x200B; (Figure1). 1 ). One liters of water were through 200- and 64-#x003bc;m nets, to separate size of plankton. Water temperature, pH, and dissolved oxygen were at the time of sampling.

The water (100 ml) was filtered using a #x003bc;m nitrocellulose membrane, was incubated in alkaline peptone (APW) at 37#x000b0;C for 24 h. An aliquot (1- to of each plankton fraction and 200-#x003bc;m) was also inoculated in APW and at 37#x000b0;C for 24 h. A 10 microliter loop of the cultures were streaked thiosulfate citrate bile (TCBS) agar plates, were incubated overnight at All colonies that appeared to green at 24 h were considered Vibrio spp. picked a sterile toothpick, and streaked to colonies on Luria#x02013;Bertani (LB) Presumptive V . parahaemolyticus colonies confirmed by streaking onto Vibrio (mauve colonies) the were confirmed by PCR (presence of tlh . and V. -specific collagenase).

Map showing locations of sampling along Black Sea .

Honda NSF 100

For molecular the following PCR primers were collagenase (Di Pinto et al. 2005 ), tdh . trh . and tlh et al. 1999 ), GS-PCR (Matsumoto et al. ), ORF8 (Nasu et al. 2000 ), (Wang et al.

2006 ), histone-like protein (HU-#x003b1; ORF) et al. 2004 ), the 850 bp pandemic strain (VPF2/VPR2) (Khan et al. 2002 ), ( yop ) and VP1339 ( escC ) of TTSS2 et al. 2010 ), VP1680 (Whitaker et al. ) and VP1686 of TTSS1 (This

Primer sequences for VP1686 VP1686-F: TGCTTTTGTGATCGCTTTTG and VP1686-R: ( T a = 56#x000b0;C; amplicon size = 169 bp) and designed in silico using V. RIMD2210633 ( NC_004603.1 / NC_004605.1 ). DNA ng) was mixed with 2.5 mM of dNTP, 15 mM of PCR and 5 U #x003bc;L #x02212;1 of Taq DNA polymerase, 20 #x003bc;m of appropriate primer for analysis. Amplicons were on 1.5% agarose gel stained ethidium bromide and examined a UV transilluminator.

To approximate the molecular diversity of the V . isolates, rep-PCR was executed on a selected subset of strains the methods of Chokesajjawatee et al. (2008 ). PCR were separated on a 1% agarose gel in TAE The resulting fingerprint patterns documented using the GelDoc-It#x02122; System (Ultra-Violet Products, CA).

Banding patterns identified by visual observation and were calculated by the unweighted method using average (UPGMA). Serotyping was performed as Strains were streaked on LB with 3% NaCl and incubated at 37#x000b0;C. One 10 #x003bc;l loopful of was homogenized in 1 mL of saline solution NaCl).

This solution was into two 500 #x003bc;l tubes, one of was boiled for 2 h. Ten microliters of the boiled solution was then mixed 10 #x003bc;l of each O-antisera and 10 of the cell suspension that had not boiled was mixed with 10 of K-antisera on a glass slide and visually determined (Denka Co. Niigata-ken, Japan). Distilled was used as a negative control for assays.

V. parahaemolyticus strain (KP positive; serotype O3:K6) for

Predictive models of V. parahaemolyticus were determined by examining the between presence/absence (response and recorded environmental parameters variables) at the time of sample Environmental parameters were evaluated as explanatory variables by the distance from optimality for data point.

This was performed by subtracting the values of all parameters for those in which V. parahaemolyticus had been (optimal parameters) from all points following the methods of et al. (2010 ) and Banakar et al. (2011 ). The values of differences were as explanatory variables in binary regression analysis. For all measures of p -values #x02264; 0.05 considered significant. Statistical were conducted on R ( ) and SAS (Cary, NC, USA).


of V. parahaemolyticus

In total, 170 isolates of V . were recovered from Sea water and plankton samples along the Georgian coast, of 101 were from water, 30 the 64 #x003bc;m fraction, and 39 from the 200 fraction of plankton (Figure (Figure2 2 ).

Honda NSF 100
Honda NSF 100
Honda NSF 100

Interesting articles

Tagged as:

Other articles of the category "Honda":

Our partners
Follow us
Contact us
Our contacts

Born in the USSR


About this site

For all questions about advertising, please contact listed on the site.

Motorcycles catalog with specifications, pictures, ratings, reviews and discusssions about Motorcycles.